eSpCas9(1.1)_No_FLAG_ATP1A1-G7
(Plasmid #173203)

• Purpose: Expresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.
• Depositing Lab: Yannick Doyon
• Depositing Organization: Universite Laval
  Located in Canada
• Publication: Levesque et al Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Total vector size (bp): 8439
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
• gRNA/shRNA sequence: GTCACAGATCGATAGTAGTG
• Species: H. sapiens (human)
• Promoter: U6 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ATP1A1 G7 sgRNA target ATP1A1 intron 17 and this plasmid can be used to directly target a transgene to the ATP1A1 locus itselft, including the mTOR Signaling Indicator (TOSI) using ATP1A1_T804N_hPGK1_mScarlet-I-TOSI_Donor.
This plasmid is derived from eSpCas9(1.1) (Plasmid #71814) from Feng Zhang's lab. The 3x FLAG sequence was removed to prevent interference of the tag in western blot and immunoprecipitation applications. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

DNA (Catalog # 173203-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 173203-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.