Skip to main content

Lenti-sgTsc1#2/Cre
(Plasmid #173658)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173658 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLL3.3
  • Vector type
    Lentiviral, Cre/Lox, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targeting Tsc1
  • gRNA/shRNA sequence
    ATCGTGTGGCTCCTGCAAGG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Tsc1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-sgTsc1#2/Cre was a gift from Charles Swanton (Addgene plasmid # 173658 ; http://n2t.net/addgene:173658 ; RRID:Addgene_173658)
  • For your References section:

    A functional taxonomy of tumor suppression in oncogenic KRAS-driven lung cancer. Cai H, Chew SK, Li C, Tsai MK, Andrejka L, Murray CW, Hughes NW, Shuldiner EG, Ashkin EL, Tang R, Hung KL, Chen LC, Lee SYC, Yousefi M, Lin WY, Kunder CA, Cong L, McFarland CD, Petrov DA, Swanton C, Winslow MM. Cancer Discov. 2021 Feb 19. pii: 2159-8290.CD-20-1325. doi: 10.1158/2159-8290.CD-20-1325. 10.1158/2159-8290.CD-20-1325 PubMed 33608386