pTol2-HybridBarcode
(Plasmid
#174037)
-
PurposeFor Tol2 transgenesis of expressed barcode containing SpyCas9, SauCas9, and LbCas12a target sites
-
Depositing Lab
-
Depositing OrganizationUniversity of Utah
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 174037-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 174037-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTol2
- Backbone size w/o insert (bp) 11000
- Total vector size (bp) 11500
-
Vector typeTol2 transgenesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCRISPR target sites
-
SpeciesSynthetic
-
Insert Size (bp)429
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGTAGAAATCCGGACTCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.11.07.372151v1 for bioRxiv preprint.
DNA (Catalog # 174037-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 174037-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTol2-HybridBarcode was a gift from James Gagnon (Addgene plasmid # 174037 ; http://n2t.net/addgene:174037 ; RRID:Addgene_174037) -
For your References section:
Orthogonal CRISPR-Cas tools for genome editing, inhibition, and CRISPR recording in zebrafish embryos. Takasugi PR, Wang S, Truong KT, Drage EP, Kanishka SN, Higbee MA, Bamidele N, Ojelabi O, Sontheimer EJ, Gagnon JA. Genetics. 2021 Nov 4. pii: 6420709. doi: 10.1093/genetics/iyab196. 10.1093/genetics/iyab196 PubMed 34735006
