Skip to main content
Addgene
Open Menu

VPS13D^EGFP
(Plasmid #174109)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174109 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 174109-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 174109-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.4
  • Backbone manufacturer
    Genscript
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 20000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Codon optimized VPS13D
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    14112
  • Mutation
    With an internal EGFP tag in aminoacid position 1576
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This was synthesized by Genscript.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VPS13D^EGFP was a gift from Pietro De Camilli (Addgene plasmid # 174109 ; http://n2t.net/addgene:174109 ; RRID:Addgene_174109)

  • For your References section:

    VPS13D bridges the ER to mitochondria and peroxisomes via Miro. Guillen-Samander A, Leonzino M, Hanna MG, Tang N, Shen H, De Camilli P. J Cell Biol. 2021 May 3;220(5). pii: 212021. doi: 10.1083/jcb.202010004. 10.1083/jcb.202010004 PubMed 33891013
Related items:
Commonly requested with: