PE-Cas9
(Plasmid
#174851)
-
PurposeExpress PE-Cas9 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174851 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 3438
- Total vector size (bp) 9753
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePE-Cas9
-
SpeciesSynthetic; Cas9 is from S. pyogenes; M-MLV RT is from the Moloney murine leukemia virus
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PE-Cas9 was a gift from Wen Xue (Addgene plasmid # 174851 ; http://n2t.net/addgene:174851 ; RRID:Addgene_174851) -
For your References section:
Deletion and replacement of long genomic sequences using prime editing. Jiang T, Zhang XO, Weng Z, Xue W. Nat Biotechnol. 2021 Oct 14. pii: 10.1038/s41587-021-01026-y. doi: 10.1038/s41587-021-01026-y. 10.1038/s41587-021-01026-y PubMed 34650270