Skip to main content

px459 sgFIP200
(Plasmid #175024)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175024 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 175024-D50 50 μg of DNA in Tris buffer $495
DNA 175024-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    px459
  • Backbone size w/o insert (bp) 9174
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RB1CC1
  • gRNA/shRNA sequence
    TATGTATTTCTGGTTAACAC
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_014781.5
  • Entrez Gene
    RB1CC1 (a.k.a. ATG17, CC1, FIP200, PPP1R131)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer U6 FWD
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px459 sgFIP200 was a gift from David Tumbarello (Addgene plasmid # 175024 ; http://n2t.net/addgene:175024 ; RRID:Addgene_175024)
  • For your References section:

    Loss of the Essential Autophagy Regulators FIP200 or Atg5 Leads to Distinct Effects on Focal Adhesion Composition and Organization. Assar EA, Tumbarello DA. Front Cell Dev Biol. 2020 Aug 4;8:733. doi: 10.3389/fcell.2020.00733. eCollection 2020. 10.3389/fcell.2020.00733 PubMed 32850845