pZD-CJ1111
(Plasmid
#175058)
-
PurposerbcLXS6803 integrative plasmid expresses CRE recombinase as a translational fusion to rbcL6803
-
Depositing Lab
-
Depositing OrganizationArizona State University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175058 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 5948
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCRE
-
Insert Size (bp)1065
- Promoter rbcLXS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agagagcgaacttggtcgaa
- 3′ sequencing primer ATGCATCATCAGGAGTACGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZD-CJ1111 was a gift from David Nielsen (Addgene plasmid # 175058 ; http://n2t.net/addgene:175058 ; RRID:Addgene_175058) -
For your References section:
Exploiting Polyploidy for Markerless and Plasmid-Free Genome Engineering in Cyanobacteria. Jones CM, Parrish S, Nielsen DR. ACS Synth Biol. 2021 Sep 17;10(9):2371-2382. doi: 10.1021/acssynbio.1c00269. Epub 2021 Aug 17. 10.1021/acssynbio.1c00269 PubMed 34530614