pNUT1
(Plasmid
#175746)
-
PurposeSingle-component photo-inducible (LOV2-based) nucleolus-targeting tool 1
-
Depositing Lab
-
Depositing OrganizationTexas A&M University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175746 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 175746-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 175746-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTriEx
- Total vector size (bp) 6162
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry-LOV2-NoLS (HIV Rev transactivating protein)
-
Alt namepNUT1
-
SpeciesSynthetic
-
Insert Size (bp)1224
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer T7: TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 175746-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 175746-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNUT1 was a gift from Yubin Zhou (Addgene plasmid # 175746 ; http://n2t.net/addgene:175746 ; RRID:Addgene_175746) -
For your References section:
Optical control of protein delivery and partitioning in the nucleolus. Tan P, Hong T, Cai X, Li W, Huang Y, He L, Zhou Y. Nucleic Acids Res. 2022 Mar 23. pii: 6553118. doi: 10.1093/nar/gkac191. 10.1093/nar/gkac191 PubMed 35325178
Map uploaded by the depositor.
