pAB1679 CMV-HIVNES-GS-Cas13bt3
(Plasmid
#176317)
-
PurposeCMV-HIVNES-GS-Cas13bt3 (human codon optimized Cas13bt3 expression)
-
Depositing Lab
-
Depositing OrganizationBroad Institute
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 176317-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 176317-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
- Total vector size (bp) 7744
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman codon optimized Cas13bt3
-
SpeciesPlanctomycetes bacterium isolate B28_G16 (marine sediment)
-
Insert Size (bp)2322
-
GenBank IDRKY08123.1
- Promoter CMV
-
Tag
/ Fusion Protein
- HIV NES (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taatacgactcactataggg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 176317-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 176317-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAB1679 CMV-HIVNES-GS-Cas13bt3 was a gift from Feng Zhang (Addgene plasmid # 176317 ; http://n2t.net/addgene:176317 ; RRID:Addgene_176317) -
For your References section:
Compact RNA editors with small Cas13 proteins. Kannan S, Altae-Tran H, Jin X, Madigan VJ, Oshiro R, Makarova KS, Koonin EV, Zhang F. Nat Biotechnol. 2021 Aug 30. pii: 10.1038/s41587-021-01030-2. doi: 10.1038/s41587-021-01030-2. 10.1038/s41587-021-01030-2 PubMed 34462587