pGLOW77
(Plasmid #177338)

• Purpose: C. elegans mNeonGreen co-injection marker
• Depositing Lab: Ryan Doonan
• Publication: Witten et al MicroPubl Biol. 2023 Jun 14;2023:10.17912/micropub.biology.000871. doi: 10.17912/micropub.biology.000871. eCollection 2023.

Backbone

• Vector backbone: N/A
• Backbone size w/o insert (bp): 2445
• Total vector size (bp): 5110
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Pmyo-2::mNeonGreen
• Alt name: Pmyo-2::mNG-C1::unc-54utr
• Species: C. elegans (nematode)
• Insert Size (bp): 2663
• Promoter: myo-2
• Tag / Fusion Protein:
  • mNeonGreen

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCCAGGGAAAAAGAAGGGCT
• 3′ sequencing primer: GGGAGCACAGGGAGAAAGAG

Resource Information

• Supplemental Documents:
  • pGLOW77.gb
• A portion of this plasmid was derived from a plasmid made by: Derived from pGLOW30 (Addgene #172697) and pDD268 (Addgene #132523)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

C. elegans codon-optimized mNeonGreen. Use as an array marker for CRISPR or as a general co-injection marker. Very bright mNG fluorescence in pharyngeal muscle. Inject at 2.5 ng/uL. Made by George Huang (Glow Worms '20).

pGLOW77 has 11 random mutations relative to the pCFJ90 backbone that do not affect plasmid function.