AID-mTagBFP2-loxP_myo2_neoR-loxP
(Plasmid #194055)

• Purpose: Dual-selection cassette plasmid for knocking-in AID-mTagBFP2 into the C. elegans genome
• Depositing Lab: Kota Mizumoto
• Publication: Kurashina et al STAR Protoc. 2023 Jan 13;4(1):102028. doi: 10.1016/j.xpro.2022.102028.

Backbone

• Vector backbone: loxP_myo2_neoR
• Backbone manufacturer: John Calarco's lab at University of Toronto
• Vector type: Worm Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: IAA17
• Alt name: minimal degron sequence (71-114aa)
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 132
• Entrez Gene: AXR3 (a.k.a. AT1G04250, AUXIN RESISTANT 3, AtIAA17, F19P19.31, F19P19_31, IAA17, indole-3-acetic acid inducible 17)
• Promoter: None
• Tag / Fusion Protein:
  • codon optimized mTagBFP2 (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13 (-41) Forward
• 3′ sequencing primer: pMyo2 ccctcaatgtctctacttgt

Resource Information

• Supplemental Documents:
  • AID-mTagBFP2-loxP_myo2_neoR-loxP.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry