Skip to main content

Venus-30aa-Noxa-4E-pEGFP-C1
(Plasmid #177424)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177424 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Noxa, PMA-induced protein 1
  • Alt name
    Venus-Noxa-4E, V-Noxa-4E, VNoxa-4E
  • Species
    H. sapiens (human)
  • Mutation
    4 hydrophobic residues in the BH3 region mutated to glutamic acid
  • Entrez Gene
    PMAIP1 (a.k.a. APR, NOXA)
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TGACGCAAATGGGCGGTAGG
  • 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Noxa sequence aligns with phorbol-12-myristate-13-acetate-induced protein 1 isoform 6 [H. sapiens] (NCBI Reference Sequence: NM_021127.3). Venus sequence received from Dr. Ray Truant (McMaster University).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transfection of this plasmid will express Venus-fused to the N-terminus of Noxa. Noxa BH3 region has hydrophobic positions H1-H4 mutated to glutamic acid (E), refered to as "BH3-4E" mutation, BH3 mutations: C25E, L29E, F32E, L36E. Linked by a 30 aa (aa) flexible linker, "SGLTSGALETRPGGTAGPVAGETRGRSRGG". This Venus protein contains an A207K, F224R and L232H mutations to make it monomeric. An additional A164V mutation in Venus occured in this construct, which does not appear to affect fluorescence of the protein.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Venus-30aa-Noxa-4E-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 177424 ; http://n2t.net/addgene:177424 ; RRID:Addgene_177424)