Skip to main content

pDIV494
(Plasmid #177701)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177701 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pDIV066
  • Total vector size (bp) 12820
  • Vector type
    Bacterial Expression, Yeast Expression, CRISPR
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Species
    CTG-clade compatible
  • Promoter RNR2p (Debaryomyces hansenii )
  • Tag / Fusion Protein
    • SV40 (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Nat
  • Species
    CTG-clade compatible
  • Promoter TDH3p (Candida lusitaniae)

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
  • Species
    Synthetic; CTG-Clade compatible
  • Promoter SNR52p (Candida sp)

Cloning Information for Gene/Insert 3

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Codon optimized Cas9 was derived from another plasmid pRB732 that was obtained from Prof. Richard J. Bennett

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDIV494 was a gift from Uffe Mortensen (Addgene plasmid # 177701 ; http://n2t.net/addgene:177701 ; RRID:Addgene_177701)
  • For your References section:

    A CRISPR/Cas9 method facilitates efficient oligo-mediated gene editing in Debaryomyces hansenii. Strucko T, Andersen NL, Mahler MR, Martinez JL, Mortensen UH. Synth Biol (Oxf). 2021 Oct 12;6(1):ysab031. doi: 10.1093/synbio/ysab031. eCollection 2021. 10.1093/synbio/ysab031 PubMed 34746438