sm-9xGCN4-Renilla-MS2
(Plasmid
#178009)
-
PurposeExpresses Spaghetti Monster (sm) 9xGCN4-Renilla mRNA reporter in mammalian cells
-
Depositing Lab
-
Depositing OrganizationFriedrich Miescher Institute for Biomedical Research
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 178009-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 178009-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSF4
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesm-9xGCN4
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAGGTGGAGGTTCTGGAGGAGAAGAACTTTTGAGCAAGAATT
- 3′ sequencing primer GCTGACCGGTGCGGCCGCTGGCCTGAGCCTGAGCCCTTTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 178009-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 178009-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sm-9xGCN4-Renilla-MS2 was a gift from Jeffrey Chao (Addgene plasmid # 178009 ; http://n2t.net/addgene:178009 ; RRID:Addgene_178009) -
For your References section:
Live imaging of the co-translational recruitment of XBP1 mRNA to the ER and its processing by diffuse, non-polarized IRE1alpha. Gomez-Puerta S, Ferrero R, Hochstoeger T, Zubiri I, Chao J, Aragon T, Voigt F. Elife. 2022 Jun 22;11. pii: 75580. doi: 10.7554/eLife.75580. 10.7554/eLife.75580 PubMed 35730412
