CanlonicSF
(Plasmid
#178342)
-
PurposeTo explore lactate dynamics in intact systems
-
Depositing Lab
-
Depositing OrganizationCentro de Estudios Cientificos
Located in Chile -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1(-)GW
-
Backbone manufacturerIn house
- Backbone size w/o insert (bp) 5470
- Total vector size (bp) 7227
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCanlonicSF
-
Alt nameCalcium-and-Lactate Optical Nano-Indicator from CECs Single Fluorophore
-
SpeciesSynthetic
-
Insert Size (bp)1757
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.10.01.322404v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CanlonicSF was a gift from Alejandro San Martín (Addgene plasmid # 178342 ; http://n2t.net/addgene:178342 ; RRID:Addgene_178342) -
For your References section:
Single-Fluorophore Indicator to Explore Cellular and Sub-cellular Lactate Dynamics. Aburto C, Galaz A, Bernier A, Sandoval PY, Holtheuer-Gallardo S, Ruminot I, Soto-Ojeda I, Hertenstein H, Schweizer JA, Schirmeier S, Pastor TP, Mardones GA, Barros LF, San Martin A. ACS Sens. 2022 Oct 28. doi: 10.1021/acssensors.2c00731. 10.1021/acssensors.2c00731 PubMed 36306435