Skip to main content

pCAX-EGFP-FBP17
(Plasmid #178365)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178365 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 178365-D50 50 μg of DNA in Tris buffer $495
DNA 178365-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCAX
  • Backbone size w/o insert (bp) 4698
  • Total vector size (bp) 7297
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Formin Binding Protein 17
  • Alt name
    FBP17
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1851
  • Entrez Gene
    FNBP1 (a.k.a. FBP17)
  • Promoter Chicken Beta Actin

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGCTCCTGGGCAACGTGC
  • 3′ sequencing primer CACTCGGAAGGACATATGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAX-EGFP-FBP17 was a gift from Erik Dent (Addgene plasmid # 178365 ; http://n2t.net/addgene:178365 ; RRID:Addgene_178365)
  • For your References section:

    Opposing functions of F-BAR proteins in neuronal membrane protrusion, tubule formation, and neurite outgrowth. Taylor KL, Taylor RJ, Richters KE, Huynh B, Carrington J, McDermott ME, Wilson RL, Dent EW. Life Sci Alliance. 2019 Jun 3;2(3). pii: 2/3/e201800288. doi: 10.26508/lsa.201800288. Print 2019 Jun. 10.26508/lsa.201800288 PubMed 31160379