PX459v3
(Plasmid
#178799)
-
Purpose(Empty Backbone) SpCas9 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178799 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)
-
Backbone manufacturerDr. Feng Zhang's Lab
- Backbone size (bp) 9174
-
Modifications to backbonegRNA scaffold sequence modified for increased gRNA expression (V3 scaffold)
-
Vector typeMammalian Expression, CRISPR
- Promoter Cbh (Cas9-2A Puro) and U6 (gRNA)
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGTTTCGCCACCTCTGACTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.07.19.604224 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX459v3 was a gift from Paul Thomas (Addgene plasmid # 178799 ; http://n2t.net/addgene:178799 ; RRID:Addgene_178799) -
For your References section:
Optimal SpCas9- and SaCas9-mediated gene editing by enhancing gRNA transcript levels through scaffold poly-T tract reduction. Chey YCJ, Gierus L, Lushington C, Arudkumar JC, B Geiger A, Staker LG, Robertson LJ, Pfitzner C, Kennedy JG, Lee RHB, Godahewa GI, Adikusuma F, Thomas PQ. BMC Genomics. 2025 Feb 12;26(1):138. doi: 10.1186/s12864-025-11317-2. 10.1186/s12864-025-11317-2 PubMed 39939860