Skip to main content

pSB-CMV-MCS-puro PM-mKate2-P2A-GEM-LTB4
(Plasmid #202643)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202643 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 202643-D50 50 μg of DNA in Tris buffer $495
DNA 202643-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSB-CMV-MCS-puro
  • Total vector size (bp) 8469
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PM-mKate2-P2A-GEM-LTB4
  • Insert Size (bp)
    2757
  • Promoter CMV
  • Tag / Fusion Protein
    • PM-mKate2 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB-CMV-MCS-puro PM-mKate2-P2A-GEM-LTB4 was a gift from Balázs Enyedi (Addgene plasmid # 202643 ; http://n2t.net/addgene:202643 ; RRID:Addgene_202643)
  • For your References section:

    A genetically encoded sensor for visualizing leukotriene B4 gradients in vivo. Tamas SX, Roux BT, Vamosi B, Dehne FG, Torok A, Fazekas L, Enyedi B. Nat Commun. 2023 Aug 1;14(1):4610. doi: 10.1038/s41467-023-40326-6. 10.1038/s41467-023-40326-6 PubMed 37528073