mAzami-Green-Galectin
(Plasmid #102419)

• Purpose: Expresses mAzami-labeled galectin 3 (Gal3) as a marker for endosomal leakage or rupture.
• Depositing Lab: Geert van den Bogaart
• Publication: Dingjan et al Sci Rep. 2016 Feb 24;6:22064. doi: 10.1038/srep22064.

Backbone

• Vector backbone: pcDNA6-myc his version B
• Backbone manufacturer: Invitrogen
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LGALS3
• Alt name: Galectin-3
• Alt name: 35 kDa lectin
• Species: H. sapiens (human)
• Insert Size (bp): 765
• GenBank ID: NM_002306.3
• Entrez Gene: LGALS3 (a.k.a. CBP35, GAL3, GALBP, GALIG, L31, LGALS2, MAC2)
• Promoter: CMV
• Tag / Fusion Protein:
  • mAzami-green (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: PspOMI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The insert is from plasmid mAG-GAL3 (Addgene plasmid #62734), from the lab of Niels Geijsen and has been described in [D’Astolfo, D. S. et al. Efficient intracellular delivery of native proteins. Cell 161, 674–690 (2015)].

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The his-tag and myc-tag are NOT in frame with the Gal3-mAzami green.