CROP-seq-opti
(Plasmid #106280)

• Purpose: A version of the CROP-seq plasmid as presented in Datlinger et al. that contains the sgRNA-(F+E)-combined optimized backbone for CRISPRi from Chen et al.
• Depositing Lab: Jay Shendure
• Publication: Hill et al Nat Methods. 2018 Feb 19. pii: nmeth.4604. doi: 10.1038/nmeth.4604.

Backbone

• Vector backbone: lentiGuide-puro
  (Search Vector Database)
• Backbone manufacturer: Feng Zhang Lab
• Total vector size (bp): 10214
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EF1a-Puro-WPRE-hU6-gRNA
• Species: Synthetic
• Promoter: U6

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTGGGCACTGACAATTCCGT

Resource Information

• Supplemental Documents:
  • sgopti-crop-seq-guide-puro.gb
• Terms and Licenses:
  • UBMTA
• Industry Terms:
  • Not Available to Industry
• Articles Citing this Plasmid:
  • 3 References