Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHR-SFFV-dCas9-BFP-KRAB
(Plasmid #46911)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46911 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHR
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 9000
  • Total vector size (bp) 14167
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-BFP-KRAB fusion
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5172
  • Promoter SFFV
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • 2xNLS (C terminal on insert)
    • BFP (C terminal on insert)
    • KRAB domain (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gcttcccgagctctataaaagag
  • 3′ sequencing primer CCAGAGGTTGATTATCGATAAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The Cas9 gene was a gift from Martin Jinek and Jennifer Doudna
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was used in the experiments requiring stable expression of KRAB-dCas9 fusion protein from Gilbert et al., 2014 "Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation." Cell 159(3):647-61 PubMed ID: 25307932

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-SFFV-dCas9-BFP-KRAB was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid # 46911 ; http://n2t.net/addgene:46911 ; RRID:Addgene_46911)
  • For your References section:

    CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. 10.1016/j.cell.2013.06.044 PubMed 23849981