Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #60954)


Item Catalog # Description Quantity Price (USD)
Plasmid 60954 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 9000
  • Total vector size (bp) 14247
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    KRAB-dCas9-P2A-mCherry fusion
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter SFFV
  • Tags / Fusion Proteins
    • KRAB domain (N terminal on insert)
    • HA (C terminal on insert)
    • 2x NLS (C terminal on insert)
    • mCherry

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcttcccgagctctataaaagag
  • 3′ sequencing primer CCAGAGGTTGATTATCGATAAGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that this plasmid contains a different promoter compared to the inducible KRAB-dCas9-P2A-mCherry construct described in Figure 5A of the associated publication (Gilbert et al., 2014). To create an inducible version of KRAB-dCas9-P2A-mCherry, subclone the insert into a backbone with an inducible promoter, such as pTRE3G.

For stable expression of KRAB-dCas9 as described in Gilbert et al., 2014, please see pHR-SFFV-dCas9-BFP-KRAB (Addgene plasmid #46911).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-SFFV-KRAB-dCas9-P2A-mCherry was a gift from Jonathan Weissman (Addgene plasmid # 60954 ; ; RRID:Addgene_60954)
  • For your References section:

    Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS. Cell. 2014 Oct 23;159(3):647-61. doi: 10.1016/j.cell.2014.09.029. Epub 2014 Oct 9. 10.1016/j.cell.2014.09.029 PubMed 25307932