Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

lenti dCAS-VP64_Blast
(Plasmid #61425)


Item Catalog # Description Quantity Price (USD)
Plasmid 61425 Standard format: Plasmid sent in bacteria as agar stab 1 $65
Lentiviral Prep 61425-LV
Concentrated Lentiviral Prep 61425-LVC Limited Stock Available, 4 units left
Virus (50µL at titer > 1×10⁷ TU/mL) and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number
    High Copy


  • Gene/Insert name
    dCAS9(D10A, N863A)-VP64_2A_Blast
  • Species
    Synthetic; S. pyogenes
  • Mutation
    D10A and N863A in Cas9
  • Promoter EF1A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

IMPORTANT NOTE: If you intend to order the SAM library, this plasmid will come included with that order. Please do NOT order this plasmid if you are already planning to order the SAM library.

For additional information, protocols and an activator sgRNA design tool, visit our website:

Information for Lentiviral Prep (Catalog # 61425-LV) ( Back to top )


Ready-to-use Lentiviral Prep particles produced from lenti dCAS-VP64_Blast (#61425). In addition to the viral particles, you will also receive purified lenti dCAS-VP64_Blast plasmid DNA.


  • Volume 1 mL
  • Titer ≥1x10⁵ TU/mL
  • Pricing $100 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker Blasticidin


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 61425-LV and treated with blasticidin. Blasticidin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.
  • PCR confirmation of insert: PCR was carried out on the viral preparation with primers targeting Cas9 and the blasticidin-resistance gene. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: dCas9-F2 CCAAAGAGGTGCTGGACG
    Reverse Primer: Blast-R GCTCTTTCAATGAGGGTGGA
  • Confirmation of protein expression: A549 cells were transduced with serial dilutions of 61425-LV and treated with blasticidin. Polyclonal pools of blasticidin-resistant cells were expanded, collected, lysed and tested for Cas9 expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for Cas9, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from Cas9 should expect similarly low titers.

To demonstrate that Addgene’s virus is fully functional, Addgene has generated stable cell lines from the Cas9-expressing lentiviruses. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Information for Concentrated Lentiviral Prep (Catalog # 61425-LVC) ( Back to top )


Ready-to-use Concentrated Lentiviral Prep particles produced from lenti dCAS-VP64_Blast (#61425). In addition to the viral particles, you will also receive purified lenti dCAS-VP64_Blast plasmid DNA.


  • Volume 50 µL
  • Titer ≥1×10⁷ TU/mL
  • Pricing $150 USD for preparation of 50 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer PBS
  • Selectable Marker Blasticidin
  • Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 61425-LVC and treated with blasticidin. Blasticidin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted. Read our colony formation titering assay protocol here.
  • Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen below in the Information for Lentiviral Prep section.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti dCAS-VP64_Blast was a gift from Feng Zhang (Addgene plasmid # 61425 ; ; RRID:Addgene_61425)

    For viral preps, please replace (Addgene plasmid # 61425) in the above sentence with: (Addgene viral prep # 61425-LV) or (Addgene viral prep # 61425-LVC)

  • For your References section:

    Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202