Skip to main content

lenti dCAS-VP64_Blast
(Plasmid and Viral Vector Prep for #61425)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61425 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Lentiviral Prep 61425-LV Virus (1mL at titer > 7x10⁵ TU/mL) and Plasmid. $204
Concentrated Lentiviral Prep 61425-LVC Virus (50µL at titer > 1×10⁷ TU/mL) $232

Backbone

  • Vector backbone
    plenti
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    none
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCAS9(D10A, N863A)-VP64_2A_Blast
  • Species
    Synthetic; S. pyogenes
  • Mutation
    D10A and N863A in Cas9
  • Promoter EF1A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

IMPORTANT NOTE: If you intend to order the SAM library, this plasmid will come included with that order. Please do NOT order this plasmid if you are already planning to order the SAM library.

For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/

Purpose

Ready-to-use Lentiviral Prep particles produced from lenti dCAS-VP64_Blast (#61425). In addition to the viral particles, you will also receive purified lenti dCAS-VP64_Blast plasmid DNA.

Delivery

  • Volume 1 mL
  • Titer ≥7x10⁵ TU/mL
  • Pricing $170 USD for preparation of 1 mL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPro
  • Selectable Marker Blasticidin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Titering Method:
  • ddPCR assay: 293T cells were transduced with serial dilutions of 61425-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
Notes:
  • PCR confirmation of insert: PCR was carried out with primers targeting Cas9 and the blasticidin-resistance gene. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: dCas9-F2 CCAAAGAGGTGCTGGACG
    Reverse Primer: Blast-R GCTCTTTCAATGAGGGTGGA

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for Cas9, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from Cas9 should expect similarly low titers.

To demonstrate that Addgene’s virus is fully functional, Addgene has generated stable cell lines from the Cas9-expressing lentiviruses. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Purpose

Ready-to-use Concentrated Lentiviral Prep particles produced from lenti dCAS-VP64_Blast (#61425). In addition to the viral particles, you will also receive purified lenti dCAS-VP64_Blast plasmid DNA.

Delivery

  • Volume 50 µL
  • Titer ≥1×10⁷ TU/mL
  • Pricing $198 USD for preparation of 50 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer PBS
  • Selectable Marker Blasticidin
  • Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Titering Method:
  • ddPCR assay: 293T cells were transduced with serial dilutions of 61425-LVC, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
Notes:
  • PCR confirmation of insert: PCR was carried out with primers targeting dCas9 and the blasticidin-resistance gene. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: dCas9-F2 CCAAAGAGGTGCTGGACG
    Reverse Primer: Blast-R GCTCTTTCAATGAGGGTGGA

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti dCAS-VP64_Blast was a gift from Feng Zhang (Addgene plasmid # 61425 ; http://n2t.net/addgene:61425 ; RRID:Addgene_61425) For viral preps, please replace (Addgene plasmid # 61425) in the above sentence with: (Addgene viral prep # 61425-LV) or (Addgene viral prep # 61425-LVC)
  • For your References section:

    Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202