-
Purposelenti vector encoding the MS2-P65-HSF1 activator helper complex with a 2A Hygro resistance marker NOTE: A version of this plasmid with improved titer is available: Addgene plasmid #89308 lentiMPH v2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | |
Lentiviral Prep | 61426-LV | Virus (1mL at titer > 7x10⁵ TU/mL) and Plasmid. | |||
Concentrated Lentiviral Prep | 61426-LVC | Virus (50µL at titer ≥ 8×10⁶ TU/mL) and Plasmid. |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneplenti
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsnone
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMS2-P65-HSF1_2A_Hygro
-
SpeciesH. sapiens (human), Synthetic
-
MutationN55K in MS2
-
Entrez GeneHSF1 (a.k.a. HSTF1)
- Promoter EF1A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTT TGG ATC TTG GTT CAT TCT CAA GCC TCA G
- 3′ sequencing primer cacatagcgtaaaaggagcaacatag (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
IMPORTANT NOTES:
SAM libraries ordered prior to 4/3/2017 were shipped with this plasmid included.
As of 4/3/2017, a version of this plasmid with improved titer is available: Addgene plasmids #89308 lentiMPH v2 ( http://addgene.org/89308 )
For additional information, protocols and an activator sgRNA design tool, visit the Zhang lab website:
http://sam.genome-engineering.org/
Information for Lentiviral Prep (Catalog # 61426-LV) ( Back to top )
Purpose
Ready-to-use Lentiviral Prep particles produced from lenti MS2-P65-HSF1_Hygro (#61426). In addition to the viral particles, you will also receive purified lenti MS2-P65-HSF1_Hygro plasmid DNA.
Delivery
- Volume 1mL
- Titer ≥7x10⁵ TU/mL
- Pricing $100 USD for preparation of 1mL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- ddPCR assay: 293T cells were transduced with serial dilutions of 61426-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
- PCR confirmation of insert: PCR was carried out with primers targeting the hygromycin-resistance gene and pBluescript. The PCR product was visualized on an agarose gel for size confirmation.
Forward Primer: Hygro-F GACGGCAATTTCGATGATG
Reverse Primer: pBluescript-KS TCGAGGTCGACGGTATC
Visit our viral production page for more information.
Addgene Comments
While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for MS2-P65-HSF1, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from MS2-P65-HSF1 should expect similarly low titers.
Information for Concentrated Lentiviral Prep (Catalog # 61426-LVC) ( Back to top )
Purpose
Ready-to-use Concentrated Lentiviral Prep particles produced from lenti MS2-P65-HSF1_Hygro (#61426). In addition to the viral particles, you will also receive purified lenti MS2-P65-HSF1_Hygro plasmid DNA.
Concentrated lentiviral particles carrying MS2-P65-HSF1 and hygromycin resistance.Delivery
- Volume 50 µL
- Titer ≥8×10⁶ TU/mL
- Pricing $150 USD for preparation of 50 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids psPAX2 (plasmid #12260)
- Envelope pMD2.G (plasmid #12259)
- Buffer PBS
- Selectable Marker Hygromycin
- Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- ddPCR assay: 293T cells were transduced with serial dilutions of 61426-LVC, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
- PCR confirmation of insert: PCR was carried out with primers targeting the hygromycin-resistance gene and pBluescript. The PCR product was visualized on an agarose gel for size confirmation.
Forward Primer: Hygro-F GACGGCAATTTCGATGATG
Reverse Primer: pBluescript-KS TCGAGGTCGACGGTATC - Confirmation of protein expression: A549 cells were singly transduced with 61426-LVC or doubly transduced with 61425-LV and 61426-LVC at an MOI of 1, and treated with hygromycin or hygromycin and blasticidin, respectively. Polyclonal pools of hygromycin-resistant or hygromycin and blasticidin-resistance cells were expanded, collected, lysed and tested for p65 expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.
Visit our viral production page for more information.
Addgene Comments
While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for MS2-P65-HSF1, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from MS2-P65-HSF1 should expect similarly low titers.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti MS2-P65-HSF1_Hygro was a gift from Feng Zhang (Addgene plasmid # 61426 ; http://n2t.net/addgene:61426 ; RRID:Addgene_61426)
For viral preps, please replace (Addgene plasmid # 61426) in the above sentence with: (Addgene viral prep # 61426-LV) or (Addgene viral prep # 61426-LVC)
-
For your References section:
Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202