Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

lenti MS2-P65-HSF1_Hygro
(Plasmid #61426)


Item Catalog # Description Quantity Price (USD)
Plasmid 61426 Plasmid sent as bacteria in agar stab 1 $65
Concentrated Lentiviral Prep 61426-LVC Virus (50µL at titer ≥ 8×10⁶ TU/mL)
and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human), Synthetic
  • Mutation
    N55K in MS2
  • Entrez Gene
    HSF1 (a.k.a. HSTF1)
  • Promoter EF1A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GTT TGG ATC TTG GTT CAT TCT CAA GCC TCA G
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

Depositor Comments


SAM libraries ordered prior to 4/3/2017 were shipped with this plasmid included.

As of 4/3/2017, a version of this plasmid with improved titer is available: Addgene plasmids #89308 lentiMPH v2 ( )

For additional information, protocols and an activator sgRNA design tool, visit the Zhang lab website:

Information for Concentrated Lentiviral Prep (Catalog # 61426-LVC) ( Back to top )


Ready-to-use Concentrated Lentiviral Prep particles produced from lenti MS2-P65-HSF1_Hygro (#61426). In addition to the viral particles, you will also receive purified lenti MS2-P65-HSF1_Hygro plasmid DNA.

Concentrated lentiviral particles carrying MS2-P65-HSF1 and hygromycin resistance.


  • Volume 50 µL
  • Titer ≥8×10⁶ TU/mL
  • Pricing $360 USD for preparation of 50 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer PBS
  • Selectable Marker Hygromycin
  • Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 61426-LVC or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.
  • PCR confirmation of insert: PCR was carried out with primers targeting the hygromycin-resistance gene and pBluescript. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: Hygro-F GACGGCAATTTCGATGATG
    Reverse Primer: pBluescript-KS TCGAGGTCGACGGTATC
  • Confirmation of protein expression: A549 cells were singly transduced with 61426-LVC or doubly transduced with 61425-LV and 61426-LVC at an MOI of 1, and treated with hygromycin or hygromycin and blasticidin, respectively. Polyclonal pools of hygromycin-resistant or hygromycin and blasticidin-resistance cells were expanded, collected, lysed and tested for p65 expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for MS2-P65-HSF1, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from MS2-P65-HSF1 should expect similarly low titers.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti MS2-P65-HSF1_Hygro was a gift from Feng Zhang (Addgene plasmid # 61426)
  • For your References section:

    Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202