Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

MS2-P65-HSF1_GFP
(Plasmid #61423)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61423 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lenti(AMP)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Zeo marker is outside the LTRs and will not be packaged into virus.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    none
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MS2(N55K)-P65-HSF1_2A_GFP
  • Species
    H. sapiens (human), Synthetic
  • Mutation
    N55K in MS2
  • Entrez Gene
    HSF1 (a.k.a. HSTF1)
  • Promoter EF1A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GTT TGG ATC TTG GTT CAT TCT CAA GCC TCA G
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MS2-P65-HSF1_GFP was a gift from Feng Zhang (Addgene plasmid # 61423 ; http://n2t.net/addgene:61423 ; RRID:Addgene_61423)
  • For your References section:

    Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202