This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

dCAS9-VP64_GFP
(Plasmid #61422)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61422 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 61422-LV Virus (1 mL at titer > 1x10⁵ TU/mL)
and Plasmid. More Information
$250
Concentrated Lentiviral Prep 61422-LVC Back-ordered
Virus (125µL at titer > 1×10⁶ TU/mL)
and Plasmid. More Information
$390

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lenti(AMP)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    none
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCAS9(D10A,H840A)-VP64_2A_GFP
  • Species
    Synthetic; S. pyogenes
  • Mutation
    D10A and H840A in Cas9
  • Promoter EF1A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GTT TGG ATC TTG GTT CAT TCT CAA GCC TCA G
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/

Information for Lentiviral Prep (Catalog # 61422-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from dCAS9-VP64_GFP (#61422). In addition to the viral particles, you will also receive purified dCAS9-VP64_GFP plasmid DNA.

Lentiviral particles carrying dCas9-VP64-GFP.

Delivery

  • Volume 1 mL
  • Titer ≥1x10⁵ TU/mL
  • Pricing $220 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:

Notes:

  • PCR confirmation of insert: PCR was carried out on the viral preparation with primers targeting Cas9 and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: dCas9-F2 CCAAAGAGGTGCTGGACG
    Reverse Primer: WPRE-R CATAGCGTAAAAGGAGCAACA
  • Confirmation of protein expression: Lenti-X cells were transduced with serial dilutions of 61422-LV. 96 hours later cells were collected, lysed, and tested for dCas9 expression via immunoblotting.You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/ml, titers for large or toxic inserts, such as for Cas9, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from Cas9 should expect similarly low titers.

To demonstrate that Addgene’s virus is fully functional, Addgene has generated stable cell lines from the Cas9-expressing lentiviruses. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Information for Concentrated Lentiviral Prep (Catalog # 61422-LVC) ( Back to top )

Purpose

Ready-to-use Concentrated Lentiviral Prep particles produced from dCAS9-VP64_GFP (#61422). In addition to the viral particles, you will also receive purified dCAS9-VP64_GFP plasmid DNA.

Delivery

  • Volume 125 µL
  • Titer ≥1×10⁶ TU/mL
  • Pricing $360 USD for preparation of 125 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer PBS
  • Selectable Marker GFP
  • Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
Notes:
  • Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen in the Information for Lentiviral Prep section on this page.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dCAS9-VP64_GFP was a gift from Feng Zhang (Addgene plasmid # 61422)
  • For your References section:

    Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202