-
PurposeHuman expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, VP64 and tagBFP
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46912 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMSCV-puro
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6300
- Total vector size (bp) 11369
-
Vector typeMammalian Expression, Retroviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namedCas9-VP64-BFP fusion
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5055
- Promoter LTR
-
Tags
/ Fusion Proteins
- 3xNLS (C terminal on insert)
- BFP (C terminal on insert)
- VP64 domain (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePuromycin resistance
-
Insert Size (bp)654
- Promoter PGK
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CGGGCGCCCGAAGGTCCTCCG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Cas9 contains a N612K mutation that does not effect the function of the enzyme.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-LTR-dCas9-VP64-BFP was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid # 46912 ; http://n2t.net/addgene:46912 ; RRID:Addgene_46912) -
For your References section:
CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. 10.1016/j.cell.2013.06.044 PubMed 23849981