pSB-CMV-MCS-puro PM-mKate2-P2A-GEM-LTB4mut
(Plasmid
#202644)
-
PurposeExpresses the LTB4-insensitive control sensor GEM-LTB4mut along with the plasma membrane targeted mKate2 tag in mammalian cells
-
Depositing Lab
-
Depositing OrganizationSemmelweis University
Located in Hungary -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202644 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 202644-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 202644-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSB-CMV-MCS-puro
- Total vector size (bp) 8469
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePM-mKate2-P2A-GEM-LTB4mut
-
Insert Size (bp)2757
- Promoter CMV
-
Tag
/ Fusion Protein
- PM-mKate2 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 202644-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 202644-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB-CMV-MCS-puro PM-mKate2-P2A-GEM-LTB4mut was a gift from Balázs Enyedi (Addgene plasmid # 202644 ; http://n2t.net/addgene:202644 ; RRID:Addgene_202644) -
For your References section:
A genetically encoded sensor for visualizing leukotriene B4 gradients in vivo. Tamas SX, Roux BT, Vamosi B, Dehne FG, Torok A, Fazekas L, Enyedi B. Nat Commun. 2023 Aug 1;14(1):4610. doi: 10.1038/s41467-023-40326-6. 10.1038/s41467-023-40326-6 PubMed 37528073
