pSF11-wmiRFP2
(Plasmid
#178969)
-
PurposeExpresses miRFP2 in worm cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSF11
- Backbone size w/o insert (bp) 942
- Total vector size (bp) 7035
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namewmiRFP2
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)942
-
MutationNO
- Promoter tag-168 promoter
-
Tag
/ Fusion Protein
- no (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer acattttcaggaggacccttgg
- 3′ sequencing primer acttagaagtcagaggcacggg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSF11-wmiRFP2 was a gift from Kiryl Piatkevich (Addgene plasmid # 178969 ; http://n2t.net/addgene:178969 ; RRID:Addgene_178969) -
For your References section:
Rapid directed molecular evolution of fluorescent proteins in mammalian cells. Babakhanova S, Jung EE, Namikawa K, Zhang H, Wang Y, Subach OM, Korzhenevskiy DA, Rakitina TV, Xiao X, Wang W, Shi J, Drobizhev M, Park D, Eisenhard L, Tang H, Koster RW, Subach FV, Boyden ES, Piatkevich KD. Protein Sci. 2022 Mar;31(3):728-751. doi: 10.1002/pro.4261. Epub 2021 Dec 30. 10.1002/pro.4261 PubMed 34913537