pKeratin-emiRFP2-N1
(Plasmid
#178972)
-
PurposeExpresses the fusion protein of Keratin-emiRFP2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178972 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 3933
- Total vector size (bp) 6180
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKeratin-emiRFP2
-
SpeciesH. sapiens (human), M. musculus (mouse), Synthetic
-
Insert Size (bp)2247
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer gctattgctttatttgtaaccattataagctgc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a V282L mutation in Keratin. This mutation did not affect imaging by the depositing lab.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKeratin-emiRFP2-N1 was a gift from Kiryl Piatkevich (Addgene plasmid # 178972 ; http://n2t.net/addgene:178972 ; RRID:Addgene_178972) -
For your References section:
Rapid directed molecular evolution of fluorescent proteins in mammalian cells. Babakhanova S, Jung EE, Namikawa K, Zhang H, Wang Y, Subach OM, Korzhenevskiy DA, Rakitina TV, Xiao X, Wang W, Shi J, Drobizhev M, Park D, Eisenhard L, Tang H, Koster RW, Subach FV, Boyden ES, Piatkevich KD. Protein Sci. 2022 Mar;31(3):728-751. doi: 10.1002/pro.4261. Epub 2021 Dec 30. 10.1002/pro.4261 PubMed 34913537