pCAG-hPPP3CC-FLAG
(Plasmid
#179162)
-
PurposeExpression vector of human protein phosphatase 3, catalytic subunit, gamma isoform (PPP3CC) tagged with FLAG at C-terminus, CAG promoter, rabbit globin poly(A) signal.
-
Depositing Lab
-
Depositing OrganizationThe University of Osaka
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179162 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 179162-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 179162-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG1.1
- Backbone size w/o insert (bp) 5175
- Total vector size (bp) 6687
-
Modifications to backbonepCAGGS was used as an original vector. FLAG sequence was added.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameprotein phosphatase 3, catalytic subunit, gamma isoform
-
Alt namePPP3CC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1512
-
Entrez GenePPP3CC (a.k.a. CALNA3, CNA3, PP2Bgamma)
-
Tag
/ Fusion Protein
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
- 3′ sequencing primer GCCACACCAGCCACCACCTTCTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 179162-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 179162-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-hPPP3CC-FLAG was a gift from Masahito Ikawa (Addgene plasmid # 179162 ; http://n2t.net/addgene:179162 ; RRID:Addgene_179162) -
For your References section:
Sperm calcineurin inhibition prevents mouse fertility with implications for male contraceptive. Miyata H, Satouh Y, Mashiko D, Muto M, Nozawa K, Shiba K, Fujihara Y, Isotani A, Inaba K, Ikawa M. Science. 2015 Oct 23;350(6259):442-5. doi: 10.1126/science.aad0836. Epub 2015 Oct 1. 10.1126/science.aad0836 PubMed 26429887