Skip to main content

pSSa30
(Plasmid #179502)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179502 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 179502-D50 50 μg of DNA in Tris buffer $495
DNA 179502-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCgACU-5
  • Selectable markers
    SAT1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Red-shifted luciferase
  • Alt name
    CgLUCopt-mut2
  • Species
    Synthetic
  • Insert Size (bp)
    1653
  • Promoter TEF1t-HOP1 (p99CGH)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTCTTATTGACCACACCTCT
  • 3′ sequencing primer CAGGGCCCTTCTTAATGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSSa30 was a gift from Dominique Sanglard (Addgene plasmid # 179502 ; http://n2t.net/addgene:179502 ; RRID:Addgene_179502)
  • For your References section:

    A novel Candida glabrata doxycycline-inducible system for in vitro/in vivo use. Schrevens S, Sanglard D. FEMS Yeast Res. 2022 Sep 24;22(1):foac046. doi: 10.1093/femsyr/foac046. 10.1093/femsyr/foac046 PubMed 36047937