pSSa26
(Plasmid
#186784)
-
PurposeExpression of reverse transactivator (CgrtTA)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186784 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepVS29
- Total vector size (bp) 8248
-
Vector typeYeast Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCgrtTA
-
Insert Size (bp)1041
- Promoter ScPGK1p
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer GTATTTCACACCGCATAGGGT
- 3′ sequencing primer CCAACACCGTTCAACAACTCCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSSa26 was a gift from Dominique Sanglard (Addgene plasmid # 186784 ; http://n2t.net/addgene:186784 ; RRID:Addgene_186784) -
For your References section:
A novel Candida glabrata doxycycline-inducible system for in vitro/in vivo use. Schrevens S, Sanglard D. FEMS Yeast Res. 2022 Sep 24;22(1):foac046. doi: 10.1093/femsyr/foac046. 10.1093/femsyr/foac046 PubMed 36047937