AAVS1-Puro Xlone SOX17
(Plasmid
#179838)
-
PurposeDoxycycline-inducible expression of human SOX17
-
Depositing Lab
-
Depositing OrganizationPurdue University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179838 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAddgene #179837
- Backbone size w/o insert (bp) 9654
- Total vector size (bp) 10899
-
Vector typeMammalian Expression, AAV, CRISPR, TALEN, Synthetic Biology ; donor plasmid
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOX17
-
Alt nameVUR3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1245
-
Entrez GeneSOX17 (a.k.a. VUR3)
- Promoter TRE3GS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer gcgcctataaaagagtgctga
- 3′ sequencing primer cgcctgtcttaggttggagt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHuman SOX17 was cloned from Addgene plasmid #104541, a gift from David Vereide Lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Puro Xlone SOX17 was a gift from Xiaoping Bao (Addgene plasmid # 179838 ; http://n2t.net/addgene:179838 ; RRID:Addgene_179838) -
For your References section:
Temporal Expression of Transcription Factor ID2 Improves Natural Killer Cell Differentiation from Human Pluripotent Stem Cells. Jung J, Chang Y, Jin G, Lian X, Bao X. ACS Synth Biol. 2022 May 24. doi: 10.1021/acssynbio.2c00017. 10.1021/acssynbio.2c00017 PubMed 35608547