pJET-07-mNeonGreen-R11a
(Plasmid
#179890)
-
PurposeDonor with homologous arms for Rab11a to knock in mNeonGreen
-
Depositing Lab
-
Depositing OrganizationUniversity of Manchester
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 179890-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 179890-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepJet1.2
-
Backbone manufacturerThermo Scientific
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 4184
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR ; Donor for homologous based knock in
-
Selectable markersmNeonGreen
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRAB11A, member RAS oncogene family
-
Alt nameYL8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1396
-
Entrez GeneRAB11A (a.k.a. YL8)
-
Tag
/ Fusion Protein
- mNeonGreen (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGACTCACTATAGGGAGAGCG
- 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Here donor for mNeonGreen knock in to Rab11a.
Please visit https://www.biorxiv.org/content/10.1101/2021.12.03.471086v1.full for bioRxiv preprint.
DNA (Catalog # 179890-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 179890-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJET-07-mNeonGreen-R11a was a gift from Patrick Caswell (Addgene plasmid # 179890 ; http://n2t.net/addgene:179890 ; RRID:Addgene_179890) -
For your References section:
On demand expression control of endogenous genes with DExCon, DExogron and LUXon reveals differential dynamics of Rab11 family members. Gemperle J, Harrison TS, Flett C, Adamson AD, Caswell PT. Elife. 2022 Jun 16;11. pii: 76651. doi: 10.7554/eLife.76651. 10.7554/eLife.76651 PubMed 35708998
Map uploaded by the depositor.
