pJET-41-DExCon-antiGFPnanobody-mCherry-R11b
(Plasmid #179901)

• Purpose: Donor with homologous arms for Rab11b to knock in DExCon-antiGFPnanobody-mCherry module
• Depositing Lab: Patrick Caswell
• Depositing Organization: University of Manchester
  Located in the United Kingdom of Great Britain and Northern Ireland
• Publication: Gemperle et al Elife. 2022 Jun 16;11. pii: 76651. doi: 10.7554/eLife.76651.

Backbone

• Vector backbone: pJet1.2
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 5016
• Vector type: Mammalian Expression, Bacterial Expression, CRISPR ; Donor for homologous based knock in
• Selectable markers: mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: RAB11B, member RAS oncogene family
• Alt name: H-YPT3
• Alt name: NDAGSCW
• Species: H. sapiens (human)
• Insert Size (bp): 2016
• GenBank ID: NM_004218.3
• Entrez Gene: RAB11B (a.k.a. H-YPT3, NDAGSCW)
• Promoter: TRE3GS
• Tag / Fusion Protein:
  • antiGFPnanobody-mCherry (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGACTCACTATAGGGAGAGCG
• 3′ sequencing primer: AAGAACATCGATTTTCCATGGCAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Here donor for DExCon Rab11b knock in. DExCon = Doxycycline-mediated endogenous gene Expression Control. Lentiviral delivery of TetOn 3G is also required for this to work.

AntiGFPnanobody can be used to manipulate with endogenously expressed protein.
https://figshare.com/projects/DExCon_DExogron_LUXon_on-demand_expression_control_of_endogenous_genes_reveals_differential_dynamics_of_Rab11_family_members/118281.

Please visit https://www.biorxiv.org/content/10.1101/2021.12.03.471086v1.full for bioRxiv preprint.

DNA (Catalog # 179901-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 179901-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.