pD2529-CAG-Flag-mouse TGFb1
(Plasmid
#180260)
-
PurposeMouse full length TGFβ1 expression
-
Depositing Lab
-
Depositing OrganizationBoston Children's Hospital
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180260 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 180260-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 180260-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepD2529 CAG
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTGFβ1
-
Alt nameTGFb1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1083
-
Entrez GeneTgfb1 (a.k.a. TGF-beta1, TGFbeta1, Tgfb, Tgfb-1)
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCCTACAGCTCCTGGGCAA
- 3′ sequencing primer TGCCACAGATGTTACTTAGCCTTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 180260-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 180260-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pD2529-CAG-Flag-mouse TGFb1 was a gift from Timothy Springer (Addgene plasmid # 180260 ; http://n2t.net/addgene:180260 ; RRID:Addgene_180260) -
For your References section:
Loss of LRRC33-dependent TGFbeta1 activation enhances anti-tumor immunity and checkpoint blockade therapy. Jiang A, Qin Y, Springer TA. Cancer Immunol Res. 2022 Feb 18. pii: 681626. doi: 10.1158/2326-6066.CIR-21-0593. 10.1158/2326-6066.CIR-21-0593 PubMed 35181792