Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

GFP-TNFalpha
(Plasmid #28089)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 28089 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TNFalpha
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    707
  • GenBank ID
    NM_013693
  • Entrez Gene
    Tnf (a.k.a. DIF, TNF-a, TNF-alpha, TNFSF2, TNFalpha, Tnfa, Tnfsf1a, Tnlg1f)
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer ggccagatctagcacagaaagcatgatc
  • 3′ sequencing primer ggttcccgggtctcagagcaatgactccaaagta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-TNFalpha was a gift from Jennifer Stow (Addgene plasmid # 28089 ; http://n2t.net/addgene:28089 ; RRID:Addgene_28089)
  • For your References section:

    Subcompartments of the macrophage recycling endosome direct the differential secretion of IL-6 and TNFalpha. Manderson AP, Kay JG, Hammond LA, Brown DL, Stow JL. J Cell Biol. 2007 Jul 2. 178(1):57-69. 10.1083/jcb.200612131 PubMed 17606866