Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEGFP-N1-IL6
(Plasmid #111933)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 111933 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Interleukin 6
  • Alt name
    IL-6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    647
  • Mutation
    Codon optimized for expression in human cells
  • GenBank ID
    NM_000600.4
  • Entrez Gene
    IL6 (a.k.a. BSF-2, BSF2, CDF, HGF, HSF, IFN-beta-2, IFNB2, IL-6)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer GTCCAGCTCGACCAGGATGGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1-IL6 was a gift from Geert van den Bogaart (Addgene plasmid # 111933 ; http://n2t.net/addgene:111933 ; RRID:Addgene_111933)
  • For your References section:

    Interleukin-6 secretion is limited by self-signaling in endosomes. Verboogen DRJ, Revelo NH, Ter Beest M, van den Bogaart G. J Mol Cell Biol. 2018 Jul 16. pii: 5054600. doi: 10.1093/jmcb/mjy038. 10.1093/jmcb/mjy038 PubMed 30016456