pMIG II SIN-SV40-mCherry-SHP2
(Plasmid
#180800)
-
PurposeExpression of mouse SHP2 fused to N-terminal mCherry
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180800 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMIG II
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSHP2
-
SpeciesM. musculus (mouse)
-
Entrez GenePtpn11 (a.k.a. 2700084A17Rik, PTP1D, PTP2C, SAP-2, SH-PTP2, SH-PTP3, SHP-2, Shp2, Syp)
- Promoter SV40
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cccttgaacctcctcgttcgacc
- 3′ sequencing primer TGCGCATGCTAGCTATAGTTCT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMIG II SIN-SV40-mCherry-SHP2 was a gift from Enfu Hui (Addgene plasmid # 180800 ; http://n2t.net/addgene:180800 ; RRID:Addgene_180800) -
For your References section:
PD-1 and BTLA regulate T cell signaling differentially and only partially through SHP1 and SHP2. Xu X, Hou B, Fulzele A, Masubuchi T, Zhao Y, Wu Z, Hu Y, Jiang Y, Ma Y, Wang H, Bennett EJ, Fu G, Hui E. J Cell Biol. 2020 Jun 1;219(6). pii: 151801. doi: 10.1083/jcb.201905085. 10.1083/jcb.201905085 PubMed 32437509