pET28-His10-BTLAicd (AA190-289, Y226F, Y243F, Y282F)-TwinStrep
(Plasmid
#180808)
-
PurposeExpression of 10*His tagged human BTLA intracellular domain (AA190-289, Y226F, Y243F, Y282F)-TwinStrep
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180808 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET28a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBTLAint (AA190-289, Y226F, Y243F, Y282F)-TwinStrep
-
SpeciesH. sapiens (human)
-
MutationBTLA (Y226F, Y243F, Y282F)
-
Entrez GeneBTLA (a.k.a. BTLA1, CD272)
- Promoter T7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer gctagttattgctcagcgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28-His10-BTLAicd (AA190-289, Y226F, Y243F, Y282F)-TwinStrep was a gift from Enfu Hui (Addgene plasmid # 180808 ; http://n2t.net/addgene:180808 ; RRID:Addgene_180808) -
For your References section:
PD-1 and BTLA regulate T cell signaling differentially and only partially through SHP1 and SHP2. Xu X, Hou B, Fulzele A, Masubuchi T, Zhao Y, Wu Z, Hu Y, Jiang Y, Ma Y, Wang H, Bennett EJ, Fu G, Hui E. J Cell Biol. 2020 Jun 1;219(6). pii: 151801. doi: 10.1083/jcb.201905085. 10.1083/jcb.201905085 PubMed 32437509