pCW57.1_SPTLC1_WT
(Plasmid
#181920)
-
Purpose3rd generation, Inducible lentiviral plasmid for expression of human wildtype SPTLC1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 181920 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerAddgene Plasmid #41393
- Backbone size w/o insert (bp) 9354
- Total vector size (bp) 9057
-
Vector typeMammalian Expression, Lentiviral ; Mammalian expression, , Doxycycline inducible
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHuman serine palmitoyltransferase, long chain base subunit 1 (SPTLC1),
-
Alt nameSPTLC1
-
Alt nameAlso known as HSN1; LBC1; LCB1; SPT1; SPTI; HSAN1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1420
-
GenBank IDGene ID: 10558 NM_006415
-
Entrez GeneSPTLC1 (a.k.a. HSAN1, HSN1, LBC1, LCB1, SPT1, SPTI)
- Promoter tight TRE promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NHeI (unknown if destroyed)
- 3′ cloning site AgeI (unknown if destroyed)
- 5′ sequencing primer LNCX
- 3′ sequencing primer TGAAACGCCGAGTTACACGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1_SPTLC1_WT was a gift from Christian Metallo (Addgene plasmid # 181920 ; http://n2t.net/addgene:181920 ; RRID:Addgene_181920) -
For your References section:
1-deoxysphingolipid synthesis compromises anchorage-independent growth and plasma membrane endocytosis in cancer cells. Cordes T, Kuna RS, McGregor GH, Khare SV, Gengatharan J, Muthusamy T, Metallo CM. J Lipid Res. 2022 Sep 14:100281. doi: 10.1016/j.jlr.2022.100281. 10.1016/j.jlr.2022.100281 PubMed 36115594