-
PurposeFluorescent reporter for AhR activity
-
Depositing Labs
-
Depositing OrganizationINSERM U1139, Physiopathologie et pharmacotoxicologie placentaire humaine
Located in France -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182294 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 182294-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 182294-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneH2B-GFP
-
Backbone manufacturerGeoff Wahl Lab (Addgene #11680)
- Backbone size w/o insert (bp) 1646
- Total vector size (bp) 6157
-
Modifications to backboneCMV promotor was removed and replaced by XRE sequence.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXenobiotic Response Element
-
Alt nameXRE
-
Alt nameCYP1A1 promotor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1646
-
Entrez GeneCYP1A1 (a.k.a. AHH, AHRR, CP11, CYP1, CYPIA1, P1-450, P450-C, P450DX)
- Promoter XRE
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AseI (unknown if destroyed)
- 3′ cloning site BglII (unknown if destroyed)
- 5′ sequencing primer ATTAATGCTTCTGGCACATAGTAGTT
- 3′ sequencing primer AGATCTGAGCTCAGCTGGGAAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 182294-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 182294-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
XRE-H2B-eGFP was a gift from Severine Degrelle & Thierry Fournier (Addgene plasmid # 182294 ; http://n2t.net/addgene:182294 ; RRID:Addgene_182294) -
For your References section:
Novel fluorescent and secreted transcriptional reporters for quantifying activity of the xenobiotic sensor aryl hydrocarbon receptor (AHR). Degrelle SA, Ferecatu I, Fournier T. Environ Int. 2022 Sep 24;169:107545. doi: 10.1016/j.envint.2022.107545. 10.1016/j.envint.2022.107545 PubMed 36179647