-
PurposeReporter plasmid with a double-strand oligonucleotides that contain five repeats of NF-kappaB binding consensus sequence (5'-GGGGAATTTCC-3').
-
Depositing Lab
-
Depositing OrganizationCentro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional (Cinvestav), Mexico City
Located in Mexico -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185695 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 185695-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 185695-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3promoter
- Backbone size w/o insert (bp) 5010
- Total vector size (bp) 5099
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNF-kappaB
-
Alt nameNFkB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)88
-
GenBank IDU47298
-
Entrez GeneNFKB1 (a.k.a. CVID12, EBP-1, KBF1, NF-kB, NF-kB1, NF-kappa-B1, NF-kappaB, NF-kappabeta, NFKB-p105, NFKB-p50, NFkappaB)
- Promoter NF-kappaB binding site
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (not destroyed)
- 3′ cloning site SmaI (unknown if destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 185695-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 185695-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3Luc-5XNF-kappaB was a gift from Esther López-Bayghen (Addgene plasmid # 185695 ; http://n2t.net/addgene:185695 ; RRID:Addgene_185695) -
For your References section:
EAAT1-dependent slc1a3 Transcriptional Control depends on the Substrate Translocation Process. Hernandez-Melchor D, Ramirez-Martinez L, Cid L, Palafox-Gomez C, Lopez-Bayghen E, Ortega A. ASN Neuro. 2022 Jan-Dec;14:17590914221116574. doi: 10.1177/17590914221116574. 10.1177/17590914221116574 PubMed 35903937
Map uploaded by the depositor.
