Skip to main content

pGL3Luc-5XNF-kappaB
(Plasmid #185695)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185695 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 185695-D50 50 μg of DNA in Tris buffer $495
DNA 185695-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL3promoter
  • Backbone size w/o insert (bp) 5010
  • Total vector size (bp) 5099
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NF-kappaB
  • Alt name
    NFkB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    88
  • GenBank ID
    U47298
  • Entrez Gene
    NFKB1 (a.k.a. CVID12, EBP-1, KBF1, NF-kB, NF-kB1, NF-kappa-B1, NF-kappaB, NF-kappabeta, NFKB-p105, NFKB-p50, NFkappaB)
  • Promoter NF-kappaB binding site

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (not destroyed)
  • 3′ cloning site SmaI (unknown if destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3Luc-5XNF-kappaB was a gift from Esther López-Bayghen (Addgene plasmid # 185695 ; http://n2t.net/addgene:185695 ; RRID:Addgene_185695)
  • For your References section:

    EAAT1-dependent slc1a3 Transcriptional Control depends on the Substrate Translocation Process. Hernandez-Melchor D, Ramirez-Martinez L, Cid L, Palafox-Gomez C, Lopez-Bayghen E, Ortega A. ASN Neuro. 2022 Jan-Dec;14:17590914221116574. doi: 10.1177/17590914221116574. 10.1177/17590914221116574 PubMed 35903937