Skip to main content

pGW-Dronpa-Cav1.2
(Plasmid #182333)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182333 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 182333-D50 50 μg of DNA in Tris buffer $495
DNA 182333-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGW1
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 12000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cav1.2-Dronpa
  • Alt name
    CACNA1C
  • Species
    O. cuniculus (rabbit)
  • Insert Size (bp)
    7194
  • Mutation
    T1066Y, Q1070M
  • Entrez Gene
    CACNA1C (a.k.a. CACB, CaV1.2)
  • Promoter CMV
  • Tag / Fusion Protein
    • Full-length rabbit Cav1.2. (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CCGCACAAGGCCGTGGCGGTAGGG
  • 3′ sequencing primer SV40pA reverse
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGW-Dronpa-Cav1.2 was a gift from Jin Zhang (Addgene plasmid # 182333 ; http://n2t.net/addgene:182333 ; RRID:Addgene_182333)
  • For your References section:

    DrFLINC Contextualizes Super-resolution Activity Imaging. Lin W, Mo GCH, Mehta S, Zhang J. J Am Chem Soc. 2021 Sep 22;143(37):14951-14955. doi: 10.1021/jacs.1c05530. Epub 2021 Sep 13. 10.1021/jacs.1c05530 PubMed 34516108

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More