Skip to main content
Addgene
Open Menu

ttAtCas12a+int
(Plasmid #182384)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182384 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 182384-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 182384-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    GoldenGate level 0
  • Backbone size w/o insert (bp) 2247
  • Total vector size (bp) 6921
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LbCas12a coding sequence with D156R and Arabidopsis introns
  • Species
    A. thaliana (mustard weed); Lachnospiraceae bacterium
  • Insert Size (bp)
    4674
  • Mutation
    D156R + 8 Arabidopsis introns added
  • Promoter None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer TCACATGTTCTTTCCTGCG
  • 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ttAtCas12a+int was a gift from Wendy Harwood (Addgene plasmid # 182384 ; http://n2t.net/addgene:182384 ; RRID:Addgene_182384)

  • For your References section:

    Highly efficient genome editing in barley using novel LbCas12a variants and impact of sgRNA architecture. Lawrenson T, Hinchliffe A, Forner M, Harwood W. bioRxiv 2022.04.28.489853 10.1101/2022.04.28.489853
Related items:
Commonly requested with: