ttHsCas12a
(Plasmid
#182385)
-
PurposeGives high editing efficiency in barley.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182385 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneGoldenGate level 0
- Backbone size w/o insert (bp) 2240
- Total vector size (bp) 5983
-
Vector typeCRISPR ; Coding sequence only
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namettHsCas12a
-
SpeciesH. sapiens (human); Lachnospiraceae bacterium
-
Insert Size (bp)3732
-
MutationD156R
- Promoter None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer TCACATGTTCTTTCCTGCG
- 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.04.28.489853v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ttHsCas12a was a gift from Wendy Harwood (Addgene plasmid # 182385 ; http://n2t.net/addgene:182385 ; RRID:Addgene_182385) -
For your References section:
Highly efficient genome editing in barley using novel LbCas12a variants and impact of sgRNA architecture. Lawrenson T, Hinchliffe A, Forner M, Harwood W. bioRxiv 2022.04.28.489853 10.1101/2022.04.28.489853