Skip to main content

pDY1243-Fluorescent RADARS
(Plasmid #182540)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182540 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 182540-D50 50 μg of DNA in Tris buffer $495
DNA 182540-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pBR322
  • Backbone manufacturer
    NEB
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mNeon
  • GenBank ID
    LC279210.1
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cacaacgaggactacaccatcgtg
  • 3′ sequencing primer gtcttcttcgcctttgctgaccat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.01.26.477951 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDY1243-Fluorescent RADARS was a gift from Omar Abudayyeh & Jonathan Gootenberg (Addgene plasmid # 182540 ; http://n2t.net/addgene:182540 ; RRID:Addgene_182540)
  • For your References section:

    Programmable eukaryotic protein synthesis with RNA sensors by harnessing ADAR. Jiang K, Koob J, Chen XD, Krajeski RN, Zhang Y, Volf V, Zhou W, Sgrizzi SR, Villiger L, Gootenberg JS, Chen F, Abudayyeh OO. Nat Biotechnol. 2022 Oct 27. pii: 10.1038/s41587-022-01534-5. doi: 10.1038/s41587-022-01534-5. 10.1038/s41587-022-01534-5 PubMed 36302988