-
PurposeFluorescent reporter for Retinoic Acid activity
-
Depositing Lab
-
Depositing OrganizationHebrew University
Located in Israel -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 183054-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 183054-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3
- Backbone size w/o insert (bp) 3350
- Total vector size (bp) 4036
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRFP
-
Insert Size (bp)680
- Promoter RARE, SV40
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
RFP under the regulation of a Retinoic Acid Response Element, which is located before the SV40 promoter. RARE sequence: cagttgggtcatttgaaggttagcagcccgggtagggttcaccgaaagttcactcg
DNA (Catalog # 183054-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 183054-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3 RARE-RFP was a gift from Chaya Kalcheim (Addgene plasmid # 183054 ; http://n2t.net/addgene:183054 ; RRID:Addgene_183054) -
For your References section:
Completion of neural crest cell production and emigration is regulated by retinoic-acid-dependent inhibition of BMP signaling. Rekler D, Kalcheim C. Elife. 2022 Apr 8;11. pii: 72723. doi: 10.7554/eLife.72723. 10.7554/eLife.72723 PubMed 35394423
