Skip to main content

pGL3 RARE-d2EGFP
(Plasmid #183055)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183055 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 183055-D50 50 μg of DNA in Tris buffer $495
DNA 183055-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL3
  • Backbone size w/o insert (bp) 3350
  • Total vector size (bp) 4209
  • Modifications to backbone
    RARE element

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    d2EGFP
  • Alt name
    destabilized EGFP
  • Insert Size (bp)
    850
  • Promoter RARE, SV40

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Destabilized EGFP under the regulation of a Retinoic Acid Response Element. Half-life 2 hrs.
RARE is located before the SV40 promoter. RARE sequence: cagttgggtcatttgaaggttagcagcccgggtagggttcaccgaaagttcactcg

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3 RARE-d2EGFP was a gift from Chaya Kalcheim (Addgene plasmid # 183055 ; http://n2t.net/addgene:183055 ; RRID:Addgene_183055)
  • For your References section:

    Completion of neural crest cell production and emigration is regulated by retinoic-acid-dependent inhibition of BMP signaling. Rekler D, Kalcheim C. Elife. 2022 Apr 8;11. pii: 72723. doi: 10.7554/eLife.72723. 10.7554/eLife.72723 PubMed 35394423